BJR
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
British Journal of Radiology (2007) 80, S49-S55
© 2007 British Institute of Radiology
doi: 10.1259/bjr/25927054
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mouiseddine, M
Right arrow Articles by Chapel, A
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mouiseddine, M
Right arrow Articles by Chapel, A

Full paper

Human mesenchymal stem cells home specifically to radiation-injured tissues in a non-obese diabetes/severe combined immunodeficiency mouse model

M Mouiseddine S François A Semont A Sache B Allenet N Mathieu J Frick D Thierry and A Chapel

Laboratoire Thérapie Cellulaire et Radioprotection Accidentelle, Institut de Radioprotection et de Sûreté Nucléaire (IRSN), BP n°17, F-92262 Fontenay aux Roses CEDEX, France

Correspondence: Alain Chapel, IRSN, DRPH/SRBE/LTCRA, BP17 Fontenay aux Roses CEDEX 92262, France. E-mail: alain.chapel{at}irsn.fr


   Abstract
Top
 Abstract
Introduction
 Material and methods
 Results
 Discussion
 References
 
The therapeutic potential of bone marrow-derived human mesenchymal stem cells (hMSC) has recently been brought into the spotlights of many fields of research. One possible application of the approach is the repair of tissue injuries related to side effects of radiotherapy. The first challenge in cell therapy is to assess the quality of the cell and the ability to retain their differentiation potential during the expansion process. Efficient delivery to the sites of intended action is also necessary. We addressed both challenges using hMSC cultured and then infused to non-obese diabetes/severe combined immunodeficiency (NOD/SCID) mice submitted to total body irradiation. Furthermore, we tested the impact of additional abdominal irradiation superimposed to total body irradiation (TBI), as a model of local therapeutic irradiation.

Our results showed that the hMSC used for transplant have been expanded without significant loss in their differentiation capacities. After transplantation into adult unconditioned mice, hMSC not only migrate in bone marrow but also into other tissues. Total body irradiation increased hMSC implantation in bone marrow and muscle and further led to engraftment in brain, heart and liver. Local irradiation in addition to TBI, increased homing of injected cells to the injured tissues and to other tissues outside the local irradiation field. Morphological recovery of irradiated tissues after MSC transplantation and/or differentiation of MSC into specific organ cell types needs to be investigated. This study suggests that using the potential of hMSC to home to various organs in response to tissue injuries might be a strategy to repair the radiation-induced damages.


   Introduction
Top
 Abstract
 Introduction
Material and methods
 Results
 Discussion
 References
 
Over 50% of all cancer patients receive radiotherapy during their treatment course. Healthy tissues close to the targeted tumour cells are exposed to ionizing radiation during radiotherapy, which can result in organ dysfunctions. As a consequence, the dose delivered to the tumour may have to be limited thus resulting in a reduced efficacy. Irradiation kills normal cells directly or indirectly and the basic issue is to replace them. Replenishment of the depleted stem cell compartment should allow better regeneration of irradiated tissues. Stem cell therapy using bone marrow mesenchymal stem cells (MSC) may be a promising therapeutic approach to improve radiation-induced normal tissue damage [1].

The first challenge in MSC transplantation is that the cultured cells retain their quality and their differentiation potential during the expansion process. Efficient delivery to the sites of intended action is also necessary. We describe here a xenogeneic experimental transplant model we developed to evaluate the full potential of MSC engraftment in irradiated tissues.

Human MSC (hMSC) were transplanted into unconditioned non-obese diabetes/severe combined immunodeficiency (NOD/SCID) mice following total body irradiation with and without additional localized exposure to the abdominal area. Our results showed that after transplantation into adult unconditioned mice, hMSC not only migrate to bone marrow and lung as previously reported [2–4] but also into other tissues. Total body irradiation increased hMSC implantation in bone marrow and muscle and, furthermore, led to engraftment in brain, heart and liver. Local irradiation, in addition to TBI, increased homing of injected cells to the injured tissues and to other tissues outside the local irradiation field. We feel these observations may be relevant to several clinical situations such as radiotherapy for the treatment of cancer or accidental irradiation, in promoting the use of MSC infusion as part of a therapeutic scheme. Nevertheless transdifferentiation and or improvement of organ morphology and or function remain to be demonstrated.


   Material and methods
Top
 Abstract
 Introduction
 Material and methods
Results
 Discussion
 References
 
In vitro studies of human MSC (hMSC)
Bone marrow samples (BM) were obtained from iliac crest aspirates from healthy volunteers after informed consent and were used in accordance with the procedures approved by the human experimentation and ethics committees of Hopital St Antoine as previously described [5].

Briefly, 50 ml of bone marrow were taken from different donors over heparin (Choay® de Sanofi-synthélabo, France). Low-density mononuclear cells were separated on Ficoll Hypaque density gradient (d: 1.077). Mononuclear cells (MNC) were plated at a concentration of 107 cells/10 ml of Dexter's medium in T-75 cm2 tissue culture flasks (McCoy's 5A medium supplemented with 12.5% fetal bovine serum (FBS), 12.5% horse serum), 1% sodium bicarbonate, 1% sodium pyruvate, 0.4% MEM non essential amino acids, 0.8% MEM essential amino acids, 1% MEM vitamin solution, 1% L-glutamine (200 mM), 1% penicillin-streptomycin solution (all from Invitrogen®, Groningen, The Netherlands), 10–6M hydrocortisone (Stem Cell Technologies®), 2 ng ml–1 human basic recombinant fibroblast growth factor (FGF) (R&D System, Abington, UK) and incubated at 37°C in humidified, 5% CO2 atmosphere. After 1 week, non-adherent cells were removed. The medium (without hydrocortisone added) was renewed. Human MSC at first passage (P1 hMSC) were plated at a density of 4x105 cells per T-75 cm2 flask. We collected and counted hMSC at second passage (P2 hMSC) when reaching 80% confluence. Prior to transplant a sample of the hMSC prepared was taken for FACS analysis.

FACS analysis
The human cells were trypsinized, washed and kept in phosphate buffer saline (PBS) supplemented with 0.5% bovine serum albumin (BSA; Sigma Chemicals Co., St Louis, MO) in aliquots of 2x105 cells. The cells were incubated with phycoerythrin (PE)-conjugated monoclonal antibody against CD105 (SH2), CD73 (SH3), or CD45 (Becton-Dickinson®) for 30 min at 4°C then washed twice in PBS containing 0.5% BSA. Cells were suspended in 200 µl of PBS 0.5% BSA, and analysed at 10 000 events per test with a FACScaliburTM BD Pharmingen. Mouse igG1 was used as an isotopic control (IOTest®).

Differentiation of hMSC: induction media of multilineage differentiation
After the second passage hMSC were plated at different cell densities and using different culture conditions in order to induce osteogenic, chondrogenic or adipogenic differentiation.

  1. Osteogenic differentiation of hMSC: Cells were plated at a density of 3x103 cells cm–2 in DMEM with L-glutamine supplemented with 10% of FBS (Gibco®) and containing 50 µg ml–1 of ascorbate-2-phosphate (Sigma®), 100 µM of Dexamethasone (Sigma®) and 10 nM de beta-glycerolphosphate (Sigma®).
  2. Chondrogenic differentiation of hMSC: Cells were plated at 50x103 cells cm–2 in DMEM with L-glutamine supplemented with 10% of FBS and containing 50 µg ml–1 of ascorbate-2-phosphate (Sigma®) and 10 ng ml–1 of transforming growth factor -TGF-beta1- (R&D system ®).
  3. Adipogenic differentiation of hMSC: Cells were plated at 20x103 cells cm–2 in DMEM with L-glutamine supplemented with 10% of FBS until confluence. After confluence, basic media is completed by 50 µg ml–1 of ascorbate-2-phosphate (Sigma®), 10 µM of Dexamethasone (Sigma®) and 50 µg ml–1 of indomethacine (Sigma®). In culture differentiation, Cells were incubated at 37°C with CO2 5% for 21 days. The medium was renewed every 3 days.

Cytochemistry assays
Cultured cells were washed twice with PBS and fixed in 2% paraformaldehyde for 10 min at room temperature. After fixation cells were washed twice with PBS.

Evaluation of osteogenic potential was performed by staining for alkaline phosphatase activity using an alizarin red solution (Sigma®) to reveal the presence of calcium deposits. Adipogenic potential was revealed by oil red O staining. The cells treated for chondrogenic induction medium were stained with Alcian Blue and Safranine O (Sigma®) to reveal proteoglycans (blue colour) and glycosaminoglycanes (red-orange colour).

In vivo experiments: hMSC infusion into NOD/SCID mouse model
NOD-LtSz-scid/scid (NOD/SCID) mice, from breeding pairs originally purchased from Jackson Laboratory (Bar Harbor, Maine), were bred in our pathogen-free unit and maintained in sterile micro-isolator cages. All experiments and procedures were performed in compliance with the French Ministry of Agriculture regulations for animal experimentation (Act n°87-847 19 October 1987, modified May 2001). A total of 45 eight-week-old mice were used for this study. Mice received a selective irradiation to the abdomen at a dose of 8 Gy (at first 4.5 Gy to the abdomen and then 3.5 Gy in TBI, dose rate 2.7 Gy min–1) using a 60Co source. Special care was taken to avoid irradiation of other body parts by using lead shielding. Each of the three groups of 10 transplanted animals had their own controls of 5 animals that did not receive hMSC. Group 1 was not irradiated before receiving hMSC infusion. Groups 2 and 3 received TBI at a sublethal dose of 3.5 Gy: Group 2 received TBI only; Group 3 received a TBI at 3.5 Gy immediately after a local irradiation to the abdomen (IA) at a dose of 4.5 Gy. The hMSC were delivered intravenously by tail vein injection with a Myjector 1 ml syringe, TERUMOTM 29G X 1/2;. 24 h after radiation exposure (using a 137Cs source). NOD/SCID mice were transplanted with a dose of 5.106 P2 hMSC in 100 µl of PBS 1X. On average, one bone marrow was used to inject 5 mice. At the time of infusion cell viability of the sample was higher than 98% as assessed by trypan blue assay. The animals were sacrificed 15 days after irradiation and the quantitative and spatial distribution of the hMSC were studied through polymerase chain reaction (PCR) and immunohistology analysis. Peripheral blood, bone marrow (femur), heart, lungs, liver, kidneys, spleen, stomach, gut, brain and quadriceps muscles were collected.

Detection and quantitative analysis of engrafted hMSC: DNA extraction and PCR analysis
Biological samples were submitted to DNA extraction and PCR analysis to detect the presence of human cells in mouse recipients. Genomic DNA for PCR analysis was prepared from tissues using the QIAamp DNA Mini Kit Qiagen®. Amplifications were performed following the standard recommended amplification conditions (Applied Biosytems, Foster City, CA) as previously described [6]. The value of DNA contained in each somatic cell (diploid) is 6.16 pg with two copies of non-repeated gene. This value was used to calculate how many gene copies contain a certain amount of human or mouse DNA (measured by PCR). Therefore DNA and copy number are proportional to the number of cells. The ratio of human DNA to mouse DNA gives directly the number of the human cell in mouse tissues. Amplification of the human beta-GLOBIN gene was used to quantify the amount of human DNA in each sample of mouse tissue after DNA extraction. Endogenous mouse RAPSYN gene (Receptor-Associated Protein at the Synapse) was also amplified, as an internal control. Absolute standard curves were generated for the human beta-GLOBIN and mouse RAPSYN genes and used to quantify the amount of human DNA in each mouse tissue. Evaluation of human specificity of human beta-GLOBIN amplification was demonstrated using tenfold dilution for 100 ng to 0.05 ng of hMSC DNA with mouse DNA, without cross reactivity, to quantify human cells in mouse tissue. One hundred nanograms of purified DNA from various tissues were amplified using TaqMan universal PCR master mix (Applied Biosytems). The primers and probe for human beta-GLOBIN were forward primer 5'GTGCACCTGACTCCTGAGGAGA3'; and reverse primer 5'CCTTGATACCAACCTGCCCAGG3'; the probe labelled with fluorescent reporter and quencher was: 5'FAM-AAGGTGAACGTGGATGAAGTTGGTGG-TAMRA-3'. The primers and probe for mouse RAPSYN gene were forward primer 5'ACCCACCCATCCTGCAAAT3' and reverse primer 5'ACCTGTCCGTGCTGCAGAA3'. In order to determine the efficiency of amplification and the assay precision, calibration curves for human beta-GLOBIN and mouse RAPSYN were constructed with a 0.99 correlation (r2) and efficiency superior to 98%. A 100% efficiency corresponds to a slope of –3.32 as determined by the following equation: Efficiency = (10(–1/slope)–1). Mouse DNA was isolated from the identical tissues of non-transplanted NOD/SCID mice and used as a negative control. In addition, human DNA was isolated from hMSC cultures and used as a positive control. The results were expressed as the number of human cells per 100 mouse cells in each tissue (directly related to the numbers of copies of human beta-GLOBIN and mouse RAPSYN).

Immunohistochemistry
Following paraformaldehyde fixation, the organs were rinsed with distilled water and dehydrated. Blocks were cut at 5 µm on a rotary microtome (LEICA®). For immunohistochemical staining of the paraffin embedded samples, sections were deparaffinized in xylene and rehydrated through ethanol baths and PBS. The sections were dipped into PBS-triton in order to increase tissue permeability, followed by rinsing in distilled water for 5 min. The sections were digested with 2% trypsin for 30 min resulting in the endogenous biotin being blocked. The polyclonal anti-beta-2-microglobuline antibody (product NCL-B2Mp, Novocastra) was added at a dilution of 1:50. Negative controls were incubated with rabbit IgG diluted to 1:100. Detection of bound primary antibody was carried out with biotinylated secondary antibody. The biotinylated anti-rabbit IgG secondary antibody was diluted to 1:200, in PBS1x, and applied for 8 min. The slides were subsequently incubated with the 6 solutions of a Ventana kit to carry out an alkaline phosphatase reaction with FARED substrate for 30 min. For antibody detection the Ventana kit was used, followed by counterstaining with hemalyn for 4 min. This procedure was controlled by NEXES 8 software. On successive sections we carried out a HES staining.

Statistical analysis
To determine the effect of tissue exposure to radiation on engraftment of hMSC, the rates of implantation were compared; statistical significance was calculated using t-test. Significance for all analysis was set at p < 0.05. All values were expressed as the mean and SEM (standard error of the mean). Each hMSC-transplantated group was constituted of 10 animals (n = 10).


   Results
Top
 Abstract
 Introduction
 Material and methods
 Results
Discussion
 References
 
hMSC expanded from BM are able to differentiate into different lineages
MSC were grown for at least two passages in culture. Phenotypic analysis showed that hMSC used in these experiments were strongly positive for the MSC specific surface antigens SH2 and SH3 [7], respectively, 37.3%±4.0 and 72.9%±3.7. Almost no contamination (0.2%±0.1 CD 45+ cells) by haematopoietic cells was evident in the samples (Table 1Go). MSC were morphologically defined by a fibroblast-like appearance (Figure 1.1Go). Before use, each batch of MSC was further characterized by confirming their specific ability to undergo osteogenic, chondrocytic and adipogenic differentiations (see Figures 1.2–1.4Go). Our results suggest that the hMSC used for transplant have been expanded without significant loss in their differentiation capacity according to the criteria for defining MSC. These experiments do not rule out the possibility that other human MSC differentiation pathways, such as muscular differentiation, might be impaired during cell processing.


View this table:
[in this window]
[in a new window]

  		Table 1. Sample analysis and phenotypic characterization of cultured-expanded hMSC following two passages and before transplant. Frequency of positive cells for specific markers of hMSC: SH2 (CD105) and SH3 (CD73) and haematopoietic cell markers (CD45)

 

Figure 1
View larger version (133K):
[in this window]
[in a new window]

  		Figure 1. In vitro differentiation of human mesenchymal stem cells (hMSC). The cultured hMSC could enter different cell lineages such as osteogenic (2), chondrogenic (3) and adipogenic (4) lineages. Undifferentiated control (1).

 
Irradiation induces severe tissue injuries in the untransplanted NOD/SCID
Previously we have demonstrated by histological analysis that 15 days following a 3.5 Gy TBI a cellular depletion and haemorrhage were observed in the bone marrow and following 8 Gy abdominal irradiation, villus atrophy was observed (data not shown) [5].

The level of engraftment is related to the extent of radiation induced injuries
Sham
Quantitative PCR analysis revealed that hMSC following their infusion into non-irradiated animals (n = 10), homed to various tissues, albeit at a very low level. Human DNA accounted for engraftment of 0.06% hMSC in lung, 0.14% and in bone marrow. No significant hMSC engraftment was found in the kidneys, gut, stomach, skin, bone and peripheral blood.

TBI
Following TBI, higher percentages of hMSC were found in the brain, heart, liver, bone marrow and muscles, when compared with non-irradiated transplanted mice. Total body irradiation did not increase significantly hMSC frequency in the lungs (0.04%).

Localized irradiation
For mice that received localized irradiation to the abdomen in addition to TBI the levels of hMSC engraftment inside the abdominal area as shown in Table 2Go. Localized irradiation significantly enhanced hMSC engraftment in stomach, kidney, gut (jejunum), spleen and liver, when compared with TBI. In organs outside the abdomen following abdominal irradiation, hMSC engraftment was increased in the lung (p<0.05) but was not different from TBI results for other organs.


View this table:
[in this window]
[in a new window]

  		Table 2. Implantation of hMSC 14 days after injection into TBI 3.5 Gy mice compared with untreated NOD/SCID (a) Percentage of human cells within the abdominal organs of animals submitted to either 3.5 Gy TBI or 3.5 Gy TBI+4.5 Gy AI

 
To identity human cells in engrafted tissues, we performed immunohistological staining using a human beta-2-microglobulin specific antibody 14 days after hMCS graft following abdominal exposure to radiation. Staining was carried out in various organs. We observed clusters of human beta-2-microglobulin positive cells in all the organs that were positive for the presence of the human beta-2-microglobulin gene by PCR analysis. Cells expressing the human beta-2-microglobulin were either isolated or gathered in clusters. As illustrated in stomach, hMSC have various localizations in tissues. Human MSC localized to muscularis externa (Figure 2aGo) and to mucosa (Figure 2bGo) (black arrows).


Figure 2
View larger version (117K):
[in this window]
[in a new window]

  		Figure 2. Localization of hMSC into abdominal irradiated areas of NO/SCID mice. Human MSC were localized into (a) muscularis externa stomach and (b) into mucosa stomach (black arrows).

 

   Discussion
Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
References
 
In order to treat a tissue injury using cell therapy, the number of cells required can be very high. Stem cells are a small percentage of the total cellularity, so their pool has to be expanded ex vivo and injected's taking into account the need for immature cells – stem cells and progenitors – or differentiated cells. To be of therapeutic use the produced cells must retain normal function, differentiation pattern and regulation during culture. Mesenchymal stem cells (MSC) have been described in the bone marrow as multipotent progenitor cells that differentiate into osteocytes, chondrocytes, adipocytes and stromal cells [8]. Because of their multiple differentiation or plasticity property, this is especially important for hMSC that could possibly repopulate other tissues than the bone marrow [9]. We here report that the cell population we have used is not only almost devoid of haematopoietic cell contamination, but has kept its specific markers (Table 1Go). Their ability to differentiate according to multiple lineage characteristics is also preserved along the expansion process (Figure 1Go).

In the context of the potential therapeutic impact of the infusion of MSC in the case of irradiation damage, we have developed a preclinical model in which hMSC were infused intravenously to irradiated NOD/SCID mice. Irradiation consisted of subletal total body irradiation at 3.5 Gy in all animals. To test the impact of localized additional lesions such as those potentially occurring in humans following irradiation (heterogeneous fields); one group was also subjected to irradiation to the abdomen (8 Gy).

Previous studies have shown detection of MSC in multiple tissues after systemic injection, in the absence of previous irradiation, in nude mice and other animal models [2, 3, 10]. However, in these studies, 2 weeks after infusion MSC were detectable only in bone marrow and spleen. In our study, in the absence of irradiation, hMSC engrafted at a very low level in multiple organs. The highest levels of MSC engraftment were detected in the lungs, muscles and bone marrow 14 days post infusion [9]. The observed presence of hMSC in the bone marrow was expected, as it is the primary residence site for MSC [11].

Total body irradiation preceding hMSC infusion increased the level of engraftment in several tissues including brain, heart, liver, bone marrow and muscle when compared with non-irradiated controls [9].

Following an additional irradiation to the abdomen, hMSC were found in numerous tissues within the local additional irradiation area. In these tissues the level of engraftment was higher than for TBI, thus suggesting that hMSC engraftment is related to the dose and geometry of irradiation.

Previous studies have used different models with local injuries generated in rodents by means other than irradiation, such as: chemical damage to alter lungs [12] or muscle [13], coronary ligation to induce myocardial infarction [14, 15], partial hepatectomy with 2-acetyl-aminofluorene to prevent hepatocyte division [16], spinal cord surgical injury [17] or use of genetically deficient animals [18]. These studies, performed with mouse MSC have shown local engraftment in injured tissues and their contribution to tissue repair by differentiation [19]. Whether MSC engraftment in irradiated tissues improves their functional recovery remains to be studied.


   Acknowledgments
 
We wish to thank Patrice Richard for his helpful contribution. Both first authors contributed equally to this work. This study was supported by grants from Electricité de France, The European Union (FIRST 6FP n°LSCH-CT-2004-503436) and the Région Ile de France.

Received for publication May 19, 2006. Revision received September 19, 2006. Accepted for publication September 28, 2006.


   References
Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 References
 

  1. Thierry D, Bertho JM, Chapel A, Gourmelon P. Cell therapy for the treatment of accidental radiation overexposure. Br J Radiol 2005;Suppl. 27:175–9.
  2. Erices AA, Allers CI, Conget PA, Rojas CV, Minguell JJ. Human cord blood-derived mesenchymal stem cells home and survive in the marrow of immunodeficient mice after systemic infusion. Cell Transplant 2003;12:555–61.[Medline]
  3. Almeida-Porada G, Zanjani ED. A large animal noninjury model for study of human stem cell plasticity. Blood Cells Mol Dis 2004;32:77–81
  4. Allers C, Sierralta WD, Neubauer S, Rivera F, Minguell JJ, Conget PA. Dynamic of distribution of human bone marrow-derived mesenchymal stem cells after transplantation into adult unconditioned mice. Transplantation 2004;78:503–8.[Medline]
  5. François S, Bensidhoum M, Mouiseddine M, Mazurier C, Allenet B, Semont A, Frick J, et al. Local irradiation induces not only homing of human Mesenchymal Stem Cells (hMSC) at exposed sites but promotes their widespread engraftment to multiple organs: a study of their quantitative distribution following irradiation damages. Stem Cells 2006;24:1020–9.[CrossRef][Medline]
  6. Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative PCR. Genome Res 1996;6:986–94.[Abstract/Free Full Text]
  7. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini FC, Krause DS, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006;8:315–17.[CrossRef][Medline]
  8. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143–7.[Abstract/Free Full Text]
  9. Gao J, Dennis JE, Muzic RF, Lundberg M, Caplan AI. The dynamic in vivo distribution of bone marrow-derived mesenchymal stem cells after infusion. Cells Tissues Organs 2001;169:12–20.[CrossRef][Medline]
  10. Chapel A, Bertho JM, Bensidhoum M, Fouillard L, Young RG, Frick J, et al. Mesenchymal stem cells home to injured tissues when co-infused with haematopoetic cells to treat a radiation-induced multi-organ failure syndrome. J Gene Med 2003;5:1028–38.[CrossRef][Medline]
  11. Bensidhoum M, Chapel A, Francois S, Demarquar C, Mazurier C, Fouillard L, et al. Homing of in vitro expanded Stro-1- or Stro-1+ human mesenchymal stem cells into the NOD/SCID mouse and their role in supporting human CD34 cell engraftment. Blood 2004;103:3313–19.[Abstract/Free Full Text]
  12. Ortiz LA, Gambelli F, McBride C, Gaupp D, Baddoo M, Kaminski N, et al. Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects. Proc Natl Acad Sci USA 2003;100:8407–11.[Abstract/Free Full Text]
  13. Santa Maria L, Rojas CV, Minguell JJ. Signals from damaged but not undamaged skeletal muscle induce myogenic differentiation of rat bone-marrow-derived mesenchymal stem cells. Exp Cell Res 2004;300:418–26.[CrossRef][Medline]
  14. Min JY, Sullivan MF, Yang Y, Zhang JP, Converso KL, Morgan JP, et al. Significant improvement of heart function by cotransplantation of human mesenchymal stem cells and fetal cardiomyocytes in postinfarcted pigs. Ann Thorac Surg 2002;74:1568–75.[Abstract/Free Full Text]
  15. Bittira B, Shum-Tim D, Al-Khaldi A, Chiu RC. Mobilization and homing of bone marrow stromal cells in myocardial infarction. Eur J Cardiothorac Surg 2003;24:393–8.[Abstract/Free Full Text]
  16. Wang X, Montini E, Al-Dhalimy M, Lagasse E, Finegold M, Grompe M. Kinetics of liver repopulation after bone marrow transplantation. Am J Pathol 2002;161:565–74.[Abstract/Free Full Text]
  17. Chopp M, Zhang XH, Li Y, Wang L, Chen J, Lu D, et al. Spinal cord injury in rat: treatment with bone marrow stromal cell transplantation. Neuroreport 2000;11:3001–5.[Medline]
  18. Jin HK, Carter JE, Huntley GW, Schuchman EH. Intracerebral transplantation of mesenchymal stem cells into acid sphingomyelinase-deficient mice delays the onset of neurological abnormalities and extends their life span. J Clin Invest 2002;109:1183–91.[CrossRef][Medline]
  19. Semont A, François S, Mouiseddine M, François A, Saché A, Frick J, et al. Mesenchymal stem cells increase self-renewal of small intestinal epithelium and accelerate its structural recover after radiation injury. Advances in Experimental Biology and Medicine: in press



This article has been cited by other articles:


Home page
 haematolHome page
C. Kyriakou, N. Rabin, A. Pizzey, A. Nathwani, and K. Yong
Factors that influence short-term homing of human bone marrow-derived mesenchymal stem cells in a xenogeneic animal model
Haematologica, October 1, 2008; 93(10): 1457 - 1465.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mouiseddine, M
Right arrow Articles by Chapel, A
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mouiseddine, M
Right arrow Articles by Chapel, A

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
BJR DMFR IMAGING  ALL BIR JOURNALS